EST 1609994 is a singleton


Sequence

>1609994 (1 EST) Length=255 TTGGAAGGTTAAACTAATACTAACCATATAGTAGCGTATTTATAAAATACATCTCTTATAAAAATTAAGAATAAGACCAG AATAGTTTAATGGTTATTGAGCAATTAATACTGACGATATACAATAAGAATAAGTCATACAGAAGTTAAGCATTACATTA CGAACCTAATCTGACTACTTTATTATGAGTTATATTCAGTACTAATAGTATAGACCTAGCTATACAAGTGAACTAGAGAG ACTCACTGATAATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1609994: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099942992143AA883032SMTBCEA000063SKSchistosoma Lambda Zap II cercariae


Date: 22:55:54 on Wed 22 Nov 117.