EST 1609995 is a singleton


Sequence

>1609995 (1 EST) Length=204 GGGTTTGTAAAATAAATAGTGTACAATGTATAGTCGTGACGACGACCGAGTCACTTTGCTATCAGTAATGCTTCTCCGAT CAAGTTGTTTTTGACCTAACATGTAAAGTATTATACAGCTGTCGTATACACAGCATGTAAATACAAAAATTCGTTTTATT ACATTTTTCAATCAAAATTATGTTAATTAATATTGTTTCTTGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609995: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099952992144AA883033SMTBCEA000066SKSchistosoma Lambda Zap II cercariae


Date: 12:49:35 on Fri 17 Nov 117.