EST 1609996 is a singleton


Sequence

>1609996 (1 EST) Length=213 GCTCCGACGTGTTGAAAACTTCGTGGAACTATCTCTATTTTCACCTTTTTAATCGAGTGTTCTCAATTACCTTAAAAACG TGTGGCAATTGACAGGTAAGTTTTTTCTTGTTCAACTCTTCAAATAGTTCGTCGTGCTGTTTCTGCCTCTACCTGTTGAT TTAGTACTACTTGAGAACTACAAATACAAGTTAAGCTTCAAGCCAAAGGTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609996: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099962992145AA883034SMTBCEA000067SKSchistosoma Lambda Zap II cercariae


Date: 13:4:29 on Sun 19 Nov 117.