EST 1609997 is a singleton


Sequence

>1609997 (1 EST) Length=172 ACTTGTTTAATGACCAATAGGTAGTTACTTTGTTTATGAGAGGTTTCAATTTCTTCGACTTGTTTAACTGCGTAACTTAC TAAGCTCCTAACTTTGTCTTGGACTACTTAATTAATAGGCGGTCATGCTAAATCAGCAATCTCGGAATAAACTGTATTTC GGAACAACCCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1609997: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16099972992146AA883035SMTBCEA000068SKSchistosoma Lambda Zap II cercariae


Date: 21:26:51 on Fri 24 Nov 117.