EST 1610075 is a singleton


Sequence

>1610075 (1 EST) Length=331 TACTCCCGCTAATCAAGTCTTCTTTTCTTCAAGTTAATTGCCGGAAAGGGTCTCCACATCGAAATGGAGAAAGGCACAAC GAGTTTTGTCGGACACACACACACACACACACAAACAAAGACGGAGAAAAAACAATGAAATAAAAATCAACGCGTAAAGG AGAGCAAACAGCGTTAGTAACAAATGTGCAGAAAACTTTATATTGGCGCGCCACACAAAATACCGCTTGACAGATGACAA AAAAAAAAAAAAAAAATCACCTTTGAGGAGGTTCTTGTAGCGTTATTGAGTTTCATCTAGTANGGAAAAGAAAATCATGA AATATATACGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1610075: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16100752992636AA883037TENU0295T.cruzi epimastigote normalized cDNA Library


Date: 19:0:41 on Wed 17 Jan 118.