EST 1610076 is a singleton


Sequence

>1610076 (1 EST) Length=215 TAACAAACAAAGAAAAAAGGAAACAATTAGTGGAGTCTGCACAGAAATAAAACGTGGACCCCCACAAGGGTGTGTCAAAG ACTTCTGGTGTACTTGGCCTTCACAGAGCCTTCCACTGGTGCCTTATCGCGTCCTTTGCGCANAGCTGCGAGAGACGCCG CTTTGGNGTAGTGGCCGTACAGCATCTACTTCTTCTTCTTCTTCGCTGCTCTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1610076: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16100762992637AA883038TENU0296T.cruzi epimastigote normalized cDNA Library


Date: 10:33:2 on Sat 18 Nov 117.