EST 1610084 is a singleton


Sequence

>1610084 (1 EST) Length=414 TAACGTGTGAGTATGAAAAGAAATAGCGTATACATAAAATGTACACCACTAGACCTCTTCAATTTTGTCCGCAGCCCCTT CTTTAGTAGTCCGACATATCCGGCCTCCACAACAGAGTTTTCCACCGCTTGCTTTGAAACAAGATCGTACGAATTATGGA GCCCGTACGTACCCACAACAAGCACCGTATCCCCCTTTTGTGCCTTGTACCGAGGTGCAATAACACGTACAGTGAGTCGA TTGCGGTACATTTTTAACTGGCCAACACGTCGCNGAGNTATCCATCCGTTCGAAGAGTAAATTGCATTGTTTCCAGCCCT GNCGTATGTTCCTCAGCCTCTTGTTCATTTCTGACGCCAATTNTGCCCAACTCGACATCGTTTTCAACCACACCCACACA CCAGACCTCGGGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1610084: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16100842992645AA883046TENU0304T.cruzi epimastigote normalized cDNA Library


Date: 17:24:10 on Wed 22 Nov 117.