EST 1610088 is a singleton


Sequence

>1610088 (1 EST) Length=362 TGTTCGCTGCAGGTGACGAAGGAACAGCAGAAGATCNAGGTGGTGATGCCACCCGTAACGACTGCCCGCCGTGACAAGGC GTGCAAGAAATACATCAGGTGATATCTTTATTTAAGCAGAAGACAAAGCACGTGCGAACGAACGCGTCCAAGGCGCTACA GGACGCCAGCATTGAAGAGAACGCCCTGCGAGACTGAATGCGCACNTGGACACAACCGTCAACGCCTTCACGGAGGAAAA GGTGGCGGACNTGGAACAGCTCGCGGCGGATGTGACATCCATGGGTGTGGACGAGTCTGACTTTGGGGCGTGAAGAGAGC GCAGATATGAGAGGAAAGAAGAAATGAAGAGGAGAAAAAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1610088: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16100882992649AA883050TENU0308T.cruzi epimastigote normalized cDNA Library


Date: 6:19:15 on Thu 23 Nov 117.