EST 1618773 is a singleton


Sequence

>1618773 (1 EST) Length=299 TTCGGCACGAGGTTTCTGTCCTATATTGCTCATCAAATACCACCAAAAAGAAAAACAACAACAACAACATTAGGAGGGTA CACACGACGTGAGATTGGCCTTCACGCAGCCACTTTCGTCATGAATTCTCTCAAGAGCGCCATGAAAGANTTGCAGGCGA CGGCTGCTCAGCTTGCGGAGTCACNTGGGCTGCAACCCGACNAGCTACCATGTCNCAAGGACGCCCTGCTGATTCTCGCA GCGGCGGCACTAAAAAATATTGAGAAGGACGAGAACATATTCTTGTCNTCATCCGAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1618773: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16187733017621AA890742TENS0588T. cruzi epimastigote normalized cDNA Library


Date: 11:52:50 on Wed 22 Nov 117.