EST 1618800 is a singleton


Sequence

>1618800 (1 EST) Length=285 TTGAACNAGGGGGAAACNGNCCNACGCAAAAAGATCCCCTTGGTNTGCCGCATCGCGGCATTTCACTGACACACCCATCG AACCCTGTCGTTTTTCTTGACATCAANTGCCCCAAACCAGCTGCCGGTGGTGAAAAGGATGGGGCACCGCATCGCATTAT GTTTGANCTCTTTGCAAATTTGGCGCCAACGTTAGCTTCAAACATGTACGGTCTGTGCGTTGGAAGCTCCACCCGTCTCG TGGAACAGCGAATTCAGCCGGCGGGCTATAAAGGGACCGTGATGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1618800: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188003017648AA890769TENS0616T. cruzi epimastigote normalized cDNA Library


Date: 10:5:43 on Fri 24 Nov 117.