EST 1618807 is a singleton


Sequence

>1618807 (1 EST) Length=297 TATATCCGGGCCCNTACAAATAAACATGAAAATTATTTTCCCTCGCCCTCATTCCTCGCCGCATGTTTTTACACAAAAAA AAAAAAAAAAATGCGGCAAACACAAAAAATGACGCTAANAGAATTAAAATAGAAATAAACACAAGATGAGCATATGCATT TATTTCTACACAGAGAAAAAAATTCAAACAAATTTCTACGGTTCGCCCCCAGCCATCTTGTACNTCTTTTCCAAACGTAC ACGCAGGTTTTGAAGCATCTCGCTTGCACTGACGCNACGGTGCTCGTCTGTCGGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1618807: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188073017655AA890776TENS0623T. cruzi epimastigote normalized cDNA Library


Date: 23:0:22 on Fri 24 Nov 117.