EST 1618808 is a singleton


Sequence

>1618808 (1 EST) Length=302 GAGAGCCGGCCCGAACTTTCACGTGAGCGCGAANNGGCAATTGGGTACTGTGTAAGAAAGAAGCGCGAGGTTACAGATGT CATTGGACTGAAGAAGCAGAGAGTGAATGAGCTAGCTTTAGACCTACAGAAAAACCTATCGGTCATTGTTGAANATCAAG AAAAGTCTGCCCTTAGTGTGGTGGAAAAAATACAAGAANAACGCAATGCACTTCGCGAAGAAGTTGAGAGTATAAAGGCT GCGAATCAGCGCCTATGGGATGTACTTCGTGACACCAAATATTCCTCAGACTCCGTTCAGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1618808: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188083017656AA890777TENS0624T. cruzi epimastigote normalized cDNA Library


Date: 17:7:49 on Wed 22 Nov 117.