EST 1618814 is a singleton


Sequence

>1618814 (1 EST) Length=263 TCGNGNCTATGGGCAAGACCNCCGACGTCACCGCAGGCNCGGCGGCCATGCAAAAGCGACAGCGGCGTTAGTGGAGGCGA TTGAGCTTGACGAGGAACTCGAGGAGAACTCCAATCAACTCCTTGACGACTACGCCATGCTGCTGGAAGCGGATGANAAC GCCAAGCGGCTTTCCGTGGAGGTGCAGCAGCTGCGGGAGCAGGAGGAGGTGTNCAAGACACACCGCGCCCTGAAGGCGAT GCGGCTCAACCAGGCCGTGGCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1618814: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188143017662AA890783TENS0630T. cruzi epimastigote normalized cDNA Library


Date: 2:40:34 on Fri 24 Nov 117.