EST 1618827 is a singleton


Sequence

>1618827 (1 EST) Length=282 CCGANGTTCAGNACCCACCGGTCCGCAGTGCTCCTGCGGCTCCTCCTGCACCGACACAGCACGGCCCACAGCCTGCTCCT GGTTACACGTACTCCCCTGCCATGCAGGANAACATGCAGTGGTGTCCTCCGCCGCGTCCCGACAACTGGGCACTCGGCCA TGGCCCAGTTGTCCCACCGTACGAACATAACCGGTATTACCAAAACATGAATTACCAGCCACCTCGTGGAAAGTCTTTTG TTCCCAGNAGTGGTGATATACCTCCGCACATGGGCCGCGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1618827: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188273017675AA890796TENS0643T. cruzi epimastigote normalized cDNA Library


Date: 2:29:3 on Wed 22 Nov 117.