EST 1618828 is a singleton


Sequence

>1618828 (1 EST) Length=278 AGCCANATAAACNTACCATGAGTTTGTGGCCCTGATGTCCAGGCGTCTCCAGTCAGACTACACGTTGGAACAGCTGCGAA ATGCCTTTAAGCTTTTTGAGACGGAAAACATGCCGCCTGGCTATGTTTCGAGGGAGGTACTGGAGCACGCCCTTGTGTCT TACGGCACAGAAAAACTCACTCACGATGAGGCGACACGCCTATTGGCTGCGGTAGATCCTGAAGGAACCGGCAGGATCAA CTATATTGAGTTTGTGTCCCTGGTGGGTGGCGGTGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1618828: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188283017676AA890797TENS0644T. cruzi epimastigote normalized cDNA Library


Date: 16:32:16 on Fri 17 Nov 117.