EST 1618830 is a singleton


Sequence

>1618830 (1 EST) Length=283 CNGTACTATATNGACCCCTCTCATCGTTTTTTTTTTCCTTTTTTTANAGGATGGGCAAACTCGGTGCCGGGCTGGACNTG AATGAAAGGCGCAAACCGGTGGGGTCCCTCTTCATGGAGGCCATGGATCGCGACGTCATTTCCCCGATCGCAGCTGCGGC AATCCCATTGTGCCGGGCCCACCGGAGGTGCATTCAGCGCGGAGGGCGGTCCCTAAACAAATGGCCTCCCATCTCGACTC CGCGGCTCAGGCCATATACAAAAAAAAACCAACGCTCTACTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1618830: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188303017678AA890799TENS0647T. cruzi epimastigote normalized cDNA Library


Date: 17:29:15 on Wed 17 Jan 118.