EST 1618831 is a singleton


Sequence

>1618831 (1 EST) Length=280 NCGGCNCGAGGTTAGGAAGTGCTTTTGCTATGTTCTGTTTTCCACTGTCTGGCTGCTGTACACCGTCGTGAATGACNAGT TCCCTCTTGTTTGCTTCTGCCACCCACACGCGGTGCCGGCCTCGCTGCTGTGCGCCCCACGGACTGCACAAACGAGGAGT GGAGGAGCAGGCCGGATGCCGCATGGAATGTGAGGGTTGTTGTGTGGGCTGGTGGAACAGTACNATCCTTTTCTTATGCT TCATTGCTTATTTTTGTGCGGGCAATGTACGCCCACACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1618831: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188313017679AA890800TENS0648T. cruzi epimastigote normalized cDNA Library


Date: 23:31:26 on Fri 17 Nov 117.