EST 1618849 is a singleton


Sequence

>1618849 (1 EST) Length=285 CNNGGATGTAAAATATCTTCATCCTGTACNANAACATATGGCAAAGCTAAGGACATATGACGCTCCTCTGGCTTCTATGC ATGAGTTGAACTCCCTTCTATCCGCTTTCAACTCTTTCTCCACCACGATGCACTATCCGAAAAGAATTGCATATGCATTT GCAGCCCATCCACACGGTAAAGAAGGGAACACGCAANATGGGTTGTGGTCTGACTGTGATTTTCAATGTGCCANATTGGG GTTGCGGTGTAATGCATCTTTGTTGATTGATACGCGAATTGCGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1618849: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188493017697AA890818TENS0666T. cruzi epimastigote normalized cDNA Library


Date: 14:24:48 on Fri 17 Nov 117.