EST 1618855 is a singleton


Sequence

>1618855 (1 EST) Length=286 GCGCCCGCCGAGGCAANGTGCGTTTGGATGAAGCACAATCGGCAGCTTCCGGAGGAANACCCGGACTACTGGAAAAAGGT GGAANTTCGAATGGATAATTTGGGACCGCTTCTTCGCTACGTCTTTGATCAGAGCAAATACAAATCTCGGCTTGACTCGT GCGAAAGTATAGTTGATGAAATGACCTTGCCGGATACCAACTATTACTCTGTTTTGGGGACTGGTAAAATGTGTGATGGT AGCCACGTCTCTCACAAACTTGTAAAGGTCGTACGAGTACNAGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1618855: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188553017703AA890824TENS0672T. cruzi epimastigote normalized cDNA Library


Date: 23:48:57 on Fri 17 Nov 117.