EST 1618860 is a singleton


Sequence

>1618860 (1 EST) Length=259 CACNAGGCGGCCCCCGAGGTATCAATGAATTNTTCGAAGTTGCGTGAGGCTTCCCGTGCCGGCATNCCGTCTCTCTACCG CAGCACTGTCTACCGCTATCTACTGGGCATCACCTTTGTTGACCATTCGCGTGAAATGTCGTTGGAACGAATGCAGGAGA AGGACTTTGAGCAGCTGTTAACAGCCTTTGGGCGAATTGTAGCATCTGACGGAACCGGGCAACGGCCCTCTGTGAAGGGA CGCATCATGCAGCCGCTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1618860: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188603017708AA890829TENS0678T. cruzi epimastigote normalized cDNA Library


Date: 6:2:52 on Thu 23 Nov 117.