EST 1618873 is a singleton


Sequence

>1618873 (1 EST) Length=295 CGAAAACCAGGACTATNGGCCCCTTTTCCTGAAAAGGGGTGNTNACGGTGGTGGCGGCTTGAGGAAATAAACGAAAAAAA NAAACGGGTGGAACTCTCATGGAAAATCANAAATTGGCGTCTTCCATCCTGCAGCCTCTGGCGTCTGGACCCAAAACCAC AACTTCTACCGCCTCGGTAACACCCCAAAAAAAAGGGCGGGCGTCTTATCTGTACAACCGCAATGGAAAACGTCTGCGTG GGTTAAAAGGCNAGGCGGCAAAACTCATGCAAAACCATCNCTTTTTTAGCAGCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1618873: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188733017721AA890842TENS0692T. cruzi epimastigote normalized cDNA Library


Date: 16:9:23 on Sat 18 Nov 117.