EST 1618877 is a singleton


Sequence

>1618877 (1 EST) Length=303 TTTAATAAAACACGAAGCGGACCAAGAGGTACTANGACGGAATACAGGCCTGGCTTGCANAGCGCTGTATCGATGATCAA TTTGGTGAGTTTGTTGGTCAGTACTCCGTGTGGGTGGAACAGATGGAGTACGANAGGTGGTTACGGCAACTACGGGATTT TGTGACGGCTTAAAACGACCCGAGAAAAAAAAAAAAAAAAAAGGATGAAANTTTACCTCCCCTTCCCCTCTCCCTTCCTC AATGAAACTAAAAATAATTGTCTCCATGTCTATTTCTGTCTGAATACATGAAAAANACAGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1618877: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188773017725AA890846TENS0696T. cruzi epimastigote normalized cDNA Library


Date: 23:0:9 on Wed 22 Nov 117.