EST 1618887 is a singleton


Sequence

>1618887 (1 EST) Length=294 TTTNTAGGNAGCACGAGGAAGGGCTTCCACCGTTANNAAAAAAGCTGGTTTGAGGCCCGTAATCCGTCATTATCTCCTGT ACCGGTTGGCCAAACCTTATCTGAACTATATGTGTACAATGGAGATATTGTCGCACAGTTGTATACAAGTTCCGCTGCAA TGCACAGCAATCTGTTGCGAAACATTTGTGGTTTACGGTCCACGGCGTCTAACATGGTGATAGCAACCCAGCGACGTTTN GAAAATGTGTTTGAANATCGAAGCAAATTTAGGAACCTTGAGCTGTTATTAGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1618887: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188873017735AA890856TENS0706T. cruzi epimastigote normalized cDNA Library


Date: 10:5:9 on Wed 22 Nov 117.