EST 1618893 is a singleton


Sequence

>1618893 (1 EST) Length=291 TANNGCCCGAGGCGCGACCCGCACCACAGCTGCTGTNCTGCAGCAAACGCAATGTTTCCGCACAGCTTCACAGGAGGGTG CTCGAATAGAAATTGATTTTGGCGACAGACGGTGGGTANAATGCTCAGCTTATGCACTCCGTCATGGACATGCGACGGAG CACGCAGCACTACGCTCATGGCGTTTGCTTGGGAGTCNTGACAAANTGCGATGGGTTGTATTGGATGAGCANAAACGTAA TAATATGCTTGGGAGGTCACCTTTTAACGTANCATCTTTCACCATTGACNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1618893: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188933017741AA890862TENS0712T. cruzi epimastigote normalized cDNA Library


Date: 18:35:50 on Sat 18 Nov 117.