EST 1618896 is a singleton


Sequence

>1618896 (1 EST) Length=289 TTTTAATAANGCACGAGGCGGACCATAAATTGGAAAAAAACANCGCGACACCCCTAACGCCACCCCTCACCGTGAACTTC AGTCGCTTCAATCAGCAATCGTCAGGCAAAATTATCGATAATGAACTGCAGCATCGCGAATCAAACCGCCATCACCACCA CTTTAGTTACTTATCCGACAAACAGGGGGACATGAATATGGCAGGGCTTGTGAACAGCACATCAAGTTCTTATTGAAATG TCTTTTTCCCATTTATATTATTACTCTACCTGCTTGTGGGTTAGTATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1618896: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16188963017744AA890865TENS0715T. cruzi epimastigote normalized cDNA Library


Date: 4:36:25 on Sat 25 Nov 117.