EST 1618908 is a singleton


Sequence

>1618908 (1 EST) Length=301 NCTTTAATAANGCACGAGGTTGAGCNCGTTTAATTGAGGTTTGTTTGATAGTACTTTTCGCAGCTCTTTGTGCAGGGGAT GAAGGGGAAAAGGAGGTGGTAAAATGCGGGGATGGAGGGAAAAAAAAAACCTCTTTTGAANAAACAAATGAAAAGGATTT TCAGCTGCTTGCTGGAGCTTTCCTTTTTTTTTTTTNCCTTTCTNCTTTTGTTTTTACTTCTTTTGTTTTTTGTTTTTATT TTTNCTTGANCGTTTGTGTTTTTCCTTTTTCACTGATTGTAAGGTGATGGCAGGGGAGGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1618908: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16189083017756AA890877TENS0727T. cruzi epimastigote normalized cDNA Library


Date: 23:56:19 on Sat 18 Nov 117.