EST 1618921 is a singleton


Sequence

>1618921 (1 EST) Length=275 TCTAGGCCNNTGCCAAATTCNGCACTAGGTNGGGTTGGCCAACACGGCCGTTCAAAGGGGAAAAAAGGGAACAGAAATGC TAGCCGTCAGCGTTTTCTCTTCTTTCCTCATGCGCCGCGTGAATTTTTTTTTTGTGCTTTGGATCTCTGCCACGGCTGCC CAGCGCCGCGGACGCGTCGGGGGANTTCTACGGGCGTTTCGGTGCCATATTGGTCTCCATCCACTCAAAAGTACGAAAAA AANANGTAGGCCCTGCGCATACTGTTGGGTGCGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1618921: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16189213017769AA890890TENS0740T. cruzi epimastigote normalized cDNA Library


Date: 2:51:11 on Sat 25 Nov 117.