EST 1618937 is a singleton


Sequence

>1618937 (1 EST) Length=288 ATTCGGCACGAGGTCNAGAAAAGGCAAAGCAACAGCAGTCCACTGATGCCCGTGCAGCCGAAGCCGACAGCCACAACGTT GTGGCTTGAGCAACAGCGCCAGAGGGAATACATGCAGCATCGCCGGCGAGTGGAGGAACAAACGTCTTGCATTGATAACA AACCGCCTCACGCGTTGAGTCTGAGCAACAAAAGGGCGCTGATGGAGCAGGAACGATGCAAACGGATCNAAGAGGAAAAC AGAAGAATTGTCCACNACNTGACAATTATTATGAANAGAGGCGGTGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1618937: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16189373017785AA890906TENS0756T. cruzi epimastigote normalized cDNA Library


Date: 0:52:56 on Wed 22 Nov 117.