EST 1618960 is a singleton


Sequence

>1618960 (1 EST) Length=258 ANGCCCCTTTTCANCACGAGGCGCANGNNCACGCCACATCATCACCACGAATTCAACACTCACCAGCGCAAACATCAGAA AGTGAAAGTGGCCCAGCANATTTCAAGCAAACATTTCCTGATATCATTGTCCCCTCCACCTCAGCTGGTGTGGGAATGGC GGAAGAANACTCTCCGCAGAACGGCAACACCGACGATTGGGCGCCGTACGGTACTTCACTTGATGTTTTGGAGGGCGTGC ACGACNAGCCTTCCAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1618960: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16189603017808AA890929TENS0779T. cruzi epimastigote normalized cDNA Library


Date: 17:25:22 on Wed 22 Nov 117.