EST 1618979 is a singleton


Sequence

>1618979 (1 EST) Length=259 AATTCGGCACGAGGGAGGCAAAATGTGATGGGGCGAAGCGATCCGAGGCGAGTGCGAAACTCGATGCCTGTGCGAATTGC CTCCTTTGGTTTGCAACGCATGTGGATGACNAAGGCGGCAATGCGGCGGTGGTTTCTTCCGTGCTGTGGTCTTTTGCCAA GTCACATGAGGANAGGCAACGGATGCTGGCCATTGCCCTCGTGGAGCGTATGAGCGGTTTACCGAAGGACNATCGGGCGC GGGAAACNAGTATTTGGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1618979: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16189793017827AA890948TENS0798T. cruzi epimastigote normalized cDNA Library


Date: 16:35:26 on Sun 19 Nov 117.