EST 1618983 is a singleton


Sequence

>1618983 (1 EST) Length=278 TANTCGGAACGAGGGCCACGANAAGCGTATTTGGCGGCCGGCATGTCNTACCTGACATAGGAGGAAAAAAAGGAACGGAA GCGTGAGGAGCAGCAACGTTTTTCACGGCAGCAGATTANNGAACNTGTCAAGAANAATCTTCCTTATACAGCCTNCGACG TGAAGTGGGTGCCGCGCAGCACGTCCTTTGCTGTGGTGGGCCNGTATCCGAATAACAAAGGCGCCATATCGGTCCTGCAG CTTAACAAGGGTGAACTGAGCGTGCAGTGCNAAATCNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1618983: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16189833017831AA890952TENS0802T. cruzi epimastigote normalized cDNA Library


Date: 1:58:30 on Sat 18 Nov 117.