EST 1618991 is a singleton


Sequence

>1618991 (1 EST) Length=257 TATTCGGCACGAGGGTGACTTGGTACGTTACATTCAGGCGCTGGAGGTTTATGCTCGCCAAGAGAATATTTCAATGATTA CTGAATTAATTTCTGGGGTACTGATGAGCCCCCGAACTGGCGTATCTGTGCCACCGGAGTCGGGGGAAACCTCCTCTGAT CGCCTCTCTCCCAGTGAGATGATTCGAATTGAGCGCCGTGTCGCCCAGACGCCACTCAAGCTGAAGTTTGGTGCTCAGGC ACCGTCTAATGTCCGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1618991: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16189913017839AA890960TENS0810T. cruzi epimastigote normalized cDNA Library


Date: 7:40:59 on Sat 18 Nov 117.