EST 1618995 is a singleton


Sequence

>1618995 (1 EST) Length=257 NCGGNACGAGGGTACAGTTGGTGGGATCCTTCGACGGGTGAAAAAAATGGCGCGCTGCANCAAGAAAACAGCTACGTGAT TGATGTTCAGTGGTCACCGGTGCTCCCAGCTGTGTTGGCCACATCATCTTTTGAACCCCTGCTTTGTGTGTCAACAGCCG AGGATGTTTCCACCGCTGCTTCTGCGGGTGGACCAGTGCCAAAGTGGCTTAAAAGGCCATGTGGTGCGTCAATCANCCTG GGTGGTTTTGTTGCCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1618995: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16189953017843AA890964TENS0814T. cruzi epimastigote normalized cDNA Library


Date: 1:43:52 on Sun 19 Nov 117.