EST 1619000 is a singleton


Sequence

>1619000 (1 EST) Length=264 AATTCGGAACGAAGGCTNNGNNTGAGGTTTTTTTCGTTTCGCTCGTGTTTTCTCGTTTCCTCAAATAAATATGATGCCCC GCCCGCCGGCCGCCATCGCAGTGCACGTCCGCCCCGCCGCGTGGAGATGTGGAANAGAGCCCCGTCGCCCGGAGACGGAG CTGCAGCGGAGAGCGCGAAGCACAACCCCGTGACGCTGCTGCTCGATTGGGGTGTGTCCGCAGTGCCGCCCGCCACACCA TCTACGCTGCCCAATAAATTTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1619000: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16190003017848AA890969TENS0819T. cruzi epimastigote normalized cDNA Library


Date: 9:32:46 on Thu 23 Nov 117.