EST 1619001 is a singleton


Sequence

>1619001 (1 EST) Length=283 GGGGGGGNTTGNCTTGGCCCCAATNCGAAAANGGGCCTTTNGCCTTGAATAACNTCAATGGTATTCTCAAGGACATGTGT GCGGCGGAGCANATCAAAGACACGGCAGCAGCTCCAACCGGAAGGGCTTTAGTGACAGCCGCAGCGGGGGCGAGCACGGC CTCATCATTGCTTTCCCCTGAGGAGTTGGAGCGGCGCAAGATGGAAATCCTGAGCAAATACGGCTTCTCGAATAGAATAT AGCACTGANACGCCGTCGCTGTGTATTATTTTGAAAGCAACGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1619001: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16190013017849AA890970TENS0820T. cruzi epimastigote normalized cDNA Library


Date: 15:23:1 on Fri 24 Nov 117.