EST 1619008 is a singleton


Sequence

>1619008 (1 EST) Length=290 GGGGNTNGCTCCGATGCCAACANTNAGGCCACAAATCGGCACGNGGGCNAATNCCACCAGAGNCAAGACGGTGTGTCCCA CGCGGCCTGCATTTGATACCGCGTTTGTAGGGCAGGCATGGATGGCAAAATACACCAATTGATACCAGTTTCTATGAAAA AATTTGCGGAGGGAATTTGCTTCTGGATGAGGCGCCGTCCNCCCNAGAGAGAGAGAGAGAACNGAGAGGGAGAGCAGCCT GTTTACATGANTTGGCTTTGTTACTTCTGAATTTGATGTGTGTGTGTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1619008: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16190083017856AA890977TENS0827T. cruzi epimastigote normalized cDNA Library


Date: 3:1:45 on Tue 21 Nov 117.