EST 1619014 is a singleton


Sequence

>1619014 (1 EST) Length=279 AAATCGGCACNAGGCGTATATAAATAAAGTAAAACGCCACTTGACCGCATGACGGTTTGTGGCTGCAATCATGCANAAAC TTTAANTCGGATTCGTACCGAAATTCATCTGGTGGAGGTGCAGTTGCGCCGCACCCGTGAGGCGCGAANAAAATACGGCA TTGGTTATGAAAGCAACACCACAGGCTGCGCTAATGAAACATTGCAAGCATCTTCAGTTGACATGGGGCCGAAGCGGGAA GTTTTGTTACTGAGTTTGCCCAGCACACCGTGCGATNAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1619014: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16190143017862AA890983TENS0833T. cruzi epimastigote normalized cDNA Library


Date: 21:50:14 on Mon 20 Nov 117.