EST 1619026 is a singleton


Sequence

>1619026 (1 EST) Length=267 ANTCGGCACGAGGCTCTTTTCGCCTCCTCACACTCCCCACGGCACTGAATGTGCGCCTGAGTCCGTTGTGCAATGTCCTT GTAAAGCAACTGCGACACCTCCTCCCAATGGGAGGCGGATGCACGCCAATCGGCAATGTCTTGTCGCACCTCCTCCCTCG CCTGCCGCAATGCACTTTCTGTGACGCCCACTAAACTCTCCATCAGCCTTACATGCTCACGTTCAANTGCACTACGGCTC TCTATAGCCTCCGCTAGACGGGACTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1619026: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16190263017874AA890995TENS0845T. cruzi epimastigote normalized cDNA Library


Date: 22:23:41 on Sat 18 Nov 117.