EST 1619030 is a singleton


Sequence

>1619030 (1 EST) Length=269 ATTCGGCACGAGGAGAATGCGAGTATTTTGTGGATGTCACCCCTGAGGTCTTTGANAGTGTGCTGAGTTTCCTGAAAACN AGTCAACTGCATCTTCCAAAGGAGAACNAGCAGCTGCGGGCGGANATTGTTCATTGCCTCAACATTTGGGGACTCCTTGA GCACGTCTTTCCTGCGGCCCCAGACGATACATCCGGCTCAGACATTGTCGAACTTCCGGGCATATGTGTGGTGCANATTT GCGACCACATGCAACACGATCAGGGCGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1619030: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16190303017878AA890999TENS0849T. cruzi epimastigote normalized cDNA Library


Date: 2:24:27 on Wed 22 Nov 117.