EST 1619045 is a singleton


Sequence

>1619045 (1 EST) Length=296 AATCGGCACGAGGCTCTTCTTGTGCCCTCTGCCTGCGCGTGTGAATGTCTCGTCGTGGATTTCCGGCGCACCGGGAGCGT TCCCCCGANAATGTTGATGGGCGCAGTATTCGCCCAAGGACANAAAACCGTATGCCCCTCGCGGANCTGGGAGCACCCGT GGTGCAGTGCGTGGACGGAATGTCAGAGGAGGCACTCTACGCCGCGATGTGCCCCAGCGATGGANAGCCACTGCCCCCCG GCTGGGANAAGGTTGTGTNTCACGGCACCATTGTTTATCTCGATCATGTGGCACGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1619045: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16190453017893AA891014TENS0864T. cruzi epimastigote normalized cDNA Library


Date: 15:54:37 on Fri 17 Nov 117.