EST 1636070 is a singleton


Sequence

>1636070 (1 EST) Length=224 CATTCGGAAANAGGCCGCAACTTNTTCTTTTTTTTTNNTTTTTTTTTTTTNCCCAAAAAANAGAAAACTCAAATAACCCA CACAATAACCCACACACGCAAACACAAAAAATACCAACACTGTTAAAAACACAAACACTCACACACNTACACACACGGAA AGCAACCTANTCCGTCCCAAACCAAACAANCCTGCTANTACAAGCNCANCAAATACTTCCNCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1636070: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16360703046111AA908039TENS0879T. cruzi epimastigote normalized cDNA Library


Date: 0:49:32 on Wed 22 Nov 117.