EST 1636162 is a singleton


Sequence

>1636162 (1 EST) Length=533 ATTCGGCACGAGGCTGGTTGTTTATTTGATGTCTGTCGTGGAGGAGTTGCGTTCANACNACNAGGTTGACCCCTGCCCGG TGTCGGAGGTCTCTGCGGGGCGTGAGAAANTCNTGGACGTTGTGGCGTGTGAGCGGCTGAAAAAGGAGGGAAACNCGCTG TTTGTCAGCGGGAAGGTTGCGGAGGCGTTGGAGGTGTACCGTGACGCGCTGAAGGCGGCGCCCATCAAACCCATTCNAAA GGAACCAAAAAATAAAAAAGGGGGCGATTCCCGGGCGGACGGCANACCGTCGGCTCCTGANACGCAGGCGAGTTCGGCCC CCGCANANGGTGGTGGTAGCAGCGGGAGCACTGCNTGCNATGAGAACGACACNNAGAATGACGTGTTGGATGAAGAAAAC AACGACGGCGGTGTCGACTACACGCTGACCTCNCNGATTTACTGTAACCNCTGGATTGTTTTTGACAAACCTGGAATTTT ATGANGACGCTGTGAACGAACTCCCCGAAGCCATNCGGCACACGGTCTGTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1636162: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16361623046203AA908131TENS0973T. cruzi epimastigote normalized cDNA Library


Date: 6:11:9 on Wed 17 Jan 118.