EST 1636173 is a singleton


Sequence

>1636173 (1 EST) Length=533 ATTCGGCACGAGGGGCGGAAACAATTACNAGTTGGTACACGAAGAGGGTCACGAGCGANAGGCCACCGAGTGCTTTGCAN AGTACGCGCAGGATTCAAGCAATGATGTTTACCTCTTCTCGACCAACANACTGAGTGATCTGCCGCCACNANACCGACTG AACGCCATTGTTGGCATTATGACCTCTCNCTGGAAGGTCAGAAATAGCAACCGCGGCTTTGACAAGGCGAAACTGCTACT TCAAGCCTTGGAATGCTTCAGCGAAATGCGTCTTTCTGGGCAAATTAAGGAATTTGAGGAGCTCCCANAGGCCGACCAGG ACACTTTTTTGCAATACGTTGANGGATGCTCCCGGTTTGCGCAGGCGTGTTCGCATTCNCATCCCAGTGCTGTTGCGATT TTGTTACGTTTGGCCCATATTTGCNAAGAAATGCGGTGTTGCNAAAAAGCGTGACNANATTATTCCCGTTGCGGAAAGGG CGGCANAACCCNTGGANCGTGCNTATCCCTTAATCCCCCNCCTGAAAANTTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1636173: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16361733046214AA908142TENS0984T. cruzi epimastigote normalized cDNA Library


Date: 15:39:54 on Fri 24 Nov 117.