EST 1645193 is a singleton


Sequence

>1645193 (1 EST) Length=224 ACCGCAGCTGTCTTGGGAAATGTTGCAGACGTTGTCTTACACATAGCTACGTTTCGATACCTATAGTTTGTCAGGTTTTA CGGGGTCAGAGACTCAGTAGCCTGTTAGATTCGAGTCTATCATCTACACCGAATTCCACAGGCTTGGGAGGTGTTGTATG TTTGTTGAACTGATAGATACGCAGTGTGGCCGTATATGTGATCATGGGTTTAACTCATGTCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1645193: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16451933056526AA917166SMTBCEA000070SKSchistosoma Lambda Zap II


Date: 10:46:9 on Tue 21 Nov 117.