EST 1645194 is a singleton


Sequence

>1645194 (1 EST) Length=273 GAGCAACCACAAGATAAATTTATAGAGAAGGAAGCTTCAGAAAAACTTAAAAGATGGCTTGACACGACATATGGTCGTCA TTGGCATGTAACTATGTCAGAGGTTCATATTGGACATCCATCCATATCAACTGTCGTTCATTTCGAAATCATCAGCATCT CATCATTATCGTACATGCATGAAGATCACGTCAGAATTATCGATCGATCACGACTACATGTGACTACTTCATAATTATGA CTAGCATACTGAGTGCATCTGCGTACTAGTAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1645194: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16451943056527AA917167SMTBCEA000076SKSchistosoma Lambda Zap II


Date: 23:14:46 on Sun 19 Nov 117.