EST 1645195 is a singleton


Sequence

>1645195 (1 EST) Length=287 CCGAGAAATATAATTTATTAGTTTATTATGATTTAATATTATATGTTTTAGGGATGAGGGTTTTTATTCCGTTATGATGT GTTATAGTAATGTGTTATCAGATATATGAGTCTTTCAAGTAAGTATATATCGAGTGATCTCGTATGAGTGTGACTGATCA CTTATAGTTAGTATAGCTTTACTGAATTAGTATATAGTCAGTCGTTCTGACAGTAGTAGTAGTCATCAGTGTATGACTAG ACTATCAGGATAGATGATCATAGACTAGTCGACGGAAGCTACGAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1645195: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16451953056528AA917134SMTBCEA000077SKSchistosoma Lambda Zap II


Date: 0:50:2 on Wed 22 Nov 117.