EST 1645199 is a singleton


Sequence

>1645199 (1 EST) Length=185 CCTCTCTCTCTATCTCTACATGTATACCGATTTGTACTTGTTTATATAAGCTTATCATCATTATTATTATTGTCAGTGCT TGCTTCGCTTGCTTCTTTCTACGATCCCGTACATAGATAAGAGTCACATCACTGTCGTATCCTTACTGGCACTTTTAACA AGATCTACACATCCATTTACATACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1645199: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16451993056532AA917138SMTBCEA000082SKSchistosoma Lambda Zap II


Date: 4:36:38 on Sat 25 Nov 117.