EST 1645200 is a singleton


Sequence

>1645200 (1 EST) Length=195 TGGGAATTAGATACCCAAGTTTAATCGGTCACCTGTCCAAGCATACTTTCAGTTTTCTTTGATTAATTTTAGTTTGGATT TTTATAATGAAATAAGGTCGCGCGTCAGATGTTAGGTAATTAATGAAATCGCAACTATTAAAGGAATCTATGTAGTTACG TGATCCTTCAATTATGAATATGGTCAAGTCTCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1645200: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452003056533AA917139SMTBCEA000083SKSchistosoma Lambda Zap II


Date: 16:26:58 on Fri 17 Nov 117.