EST 1645205 is a singleton


Sequence

>1645205 (1 EST) Length=186 AAGGCCAAGGTTTTAAGGAAACAAAAATTACGAATGTTATTAGATTAAGGAATTCTAAGACAGATAGTTAAATAGAGATA GAAAGAATATACAGAGATAGAGTTTCCCTTAAGGTTTTCCTAAGGCCTTCTCTTTTAAGAATGGTTTGGTGTTGTTGGGT GGTTTTTCTTGCCGTTTCTTTTTGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1645205: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452053056538AA917144SMTBCEA000091SKSchistosoma Lambda Zap II


Date: 11:58:31 on Thu 23 Nov 117.