EST 1645209 is a singleton


Sequence

>1645209 (1 EST) Length=250 CTTCCAGTGACAGGTATCTGAAAGCCTCTATTATACTTCTTCGACGGAGCCTGGAAATTTCACAAACTAAGGGATGATAA CAAAAAAACTTCACACTAGTACATCTTTACCGAAATCGATACGAAGGATCGTGGTTGTAGATTTTCACGTTCAAACCTAG TCAATCCGACCATTCAAGAAGAATGTGAGCGTGTTCATTGCACTGAACGACTAGTGTTAGGTCACAGTACTGAGTTCTCA ATATACGAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1645209: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16452093056542AA917148SMTBCEA000097SKSchistosoma Lambda Zap II


Date: 14:38:51 on Fri 17 Nov 117.